bio-read-qc-adapter-trimming
Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.
What this skill does
## Version Compatibility
Reference examples tested with: FastQC 0.12+, Trimmomatic 0.39+, cutadapt 4.4+, fastp 0.23+
Before using code patterns, verify installed versions match. If versions differ:
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# Adapter Trimming
Remove sequencing adapters from reads using Cutadapt (precise, flexible) or Trimmomatic (paired-end optimized).
**"Trim adapters from reads"** -> Remove sequencing adapter sequences from FASTQ reads to prevent adapter contamination in downstream alignment.
- CLI: `cutadapt -a ADAPTER -o out.fq in.fq` or `trimmomatic PE` with ILLUMINACLIP
- CLI: `fastp -i in.fq -o out.fq` (auto-detects adapters)
## Common Adapter Sequences
| Platform/Kit | Adapter | Sequence |
|--------------|---------|----------|
| Illumina TruSeq | Read 1 3' | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
| Illumina TruSeq | Read 2 3' | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT |
| Nextera | Transposase | CTGTCTCTTATACACATCT |
| Small RNA | 3' adapter | TGGAATTCTCGGGTGCCAAGG |
| Poly-A | Poly-A tail | AAAAAAAAAAAAAAAA |
## Cutadapt
### Single-End Reads
```bash
# 3' adapter (most common)
cutadapt -a AGATCGGAAGAGC -o trimmed.fastq.gz sample.fastq.gz
# 5' adapter
cutadapt -g ACGTACGT -o trimmed.fastq.gz sample.fastq.gz
# Both ends
cutadapt -a ADAPTER1 -g ADAPTER2 -o trimmed.fastq.gz sample.fastq.gz
# Multiple adapters (tries each)
cutadapt -a ADAPTER1 -a ADAPTER2 -a ADAPTER3 -o trimmed.fastq.gz sample.fastq.gz
```
### Paired-End Reads
```bash
# Basic paired-end
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
-o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
sample_R1.fastq.gz sample_R2.fastq.gz
# Short form for Illumina TruSeq (auto-detect)
cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC \
-o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
sample_R1.fastq.gz sample_R2.fastq.gz
```
### Adapter Options
```bash
# Error rate (default 0.1 = 10% mismatches allowed)
cutadapt -a ADAPTER -e 0.15 -o out.fq in.fq
# Minimum overlap (default 3)
cutadapt -a ADAPTER -O 5 -o out.fq in.fq
# No indels in adapter alignment
cutadapt -a ADAPTER --no-indels -o out.fq in.fq
# Trim Ns from ends
cutadapt --trim-n -o out.fq in.fq
# Anchored adapters (must be at end)
cutadapt -a ADAPTER$ -o out.fq in.fq
```
### Linked Adapters
```bash
# 5' adapter followed by 3' adapter (same read)
cutadapt -a ADAPTER1...ADAPTER2 -o out.fq in.fq
# Anchored 5' linked to 3'
cutadapt -a ^ADAPTER1...ADAPTER2 -o out.fq in.fq
```
### Filtering After Trimming
```bash
# Minimum length (discard shorter)
cutadapt -a ADAPTER -m 20 -o out.fq in.fq
# Maximum length
cutadapt -a ADAPTER -M 150 -o out.fq in.fq
# Maximum N content
cutadapt -a ADAPTER --max-n 0.1 -o out.fq in.fq
# Discard trimmed reads
cutadapt -a ADAPTER --discard-trimmed -o out.fq in.fq
# Discard untrimmed reads
cutadapt -a ADAPTER --discard-untrimmed -o out.fq in.fq
```
### Paired-End Filtering
```bash
# Both reads must pass minimum length
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
-o R1.fq -p R2.fq in_R1.fq in_R2.fq
# Output too-short reads separately
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
--too-short-output short_R1.fq --too-short-paired-output short_R2.fq \
-o R1.fq -p R2.fq in_R1.fq in_R2.fq
```
### Action Options
```bash
# Mask adapter instead of trim (replace with N)
cutadapt -a ADAPTER --action=mask -o out.fq in.fq
# Retain adapter but lowercase
cutadapt -a ADAPTER --action=lowercase -o out.fq in.fq
# Just find adapters, don't modify
cutadapt -a ADAPTER --action=none -o out.fq in.fq
```
## Trimmomatic
### Single-End Mode
```bash
trimmomatic SE -phred33 \
input.fastq.gz output.fastq.gz \
ILLUMINACLIP:adapters.fa:2:30:10
```
### Paired-End Mode
```bash
trimmomatic PE -phred33 -threads 4 \
input_R1.fastq.gz input_R2.fastq.gz \
output_R1_paired.fastq.gz output_R1_unpaired.fastq.gz \
output_R2_paired.fastq.gz output_R2_unpaired.fastq.gz \
ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10
```
### ILLUMINACLIP Parameters
```bash
ILLUMINACLIP:<fastaWithAdapters>:<seed>:<palindrome>:<simple>
# Parameters:
# seed - max mismatches in 16bp seed (usually 2)
# palindrome - threshold for palindrome match (usually 30)
# simple - threshold for simple match (usually 10)
# Example with all options
ILLUMINACLIP:adapters.fa:2:30:10:2:keepBothReads
```
### Built-in Adapter Files
Trimmomatic includes adapter files:
- `TruSeq2-SE.fa` - TruSeq v2 single-end
- `TruSeq2-PE.fa` - TruSeq v2 paired-end
- `TruSeq3-SE.fa` - TruSeq v3 single-end
- `TruSeq3-PE.fa` - TruSeq v3 paired-end
- `TruSeq3-PE-2.fa` - TruSeq v3 PE (palindrome mode)
- `NexteraPE-PE.fa` - Nextera paired-end
### Find Trimmomatic Adapters
```bash
# Find adapter directory
TRIMMOMATIC_JAR=$(which trimmomatic | xargs dirname)/../share/trimmomatic-*/adapters/
# Or with conda
ls $CONDA_PREFIX/share/trimmomatic-*/adapters/
```
## Performance
```bash
# Cutadapt with multiple cores
cutadapt -j 8 -a ADAPTER -o out.fq in.fq
# Trimmomatic threads
trimmomatic PE -threads 8 ...
```
## Verify Trimming
```bash
# Check adapter removal with FastQC
fastqc trimmed.fastq.gz
# Count reads before/after
zcat input.fastq.gz | wc -l
zcat trimmed.fastq.gz | wc -l
```
## Related Skills
- quality-reports - Check adapter content with FastQC
- quality-filtering - Quality trimming after adapter removal
- fastp-workflow - Combined adapter and quality trimming
Related in General
modeling-omnistudio-epc-catalog
IncludedSalesforce Industries CME EPC product-modeling skill for Product2-based catalog creation. Use when creating EPC products, configuring product attributes, building offer bundles with Product Child Items, or reviewing EPC DataPack JSON metadata for product catalog changes. TRIGGER when: user creates or updates Product2 EPC records, AttributeAssignment payloads, AttributeMetadata/AttributeDefaultValues, Offer bundles, or ProductChildItem relationships. DO NOT TRIGGER when: designing OmniScripts/FlexCards/Integration Procedures (use building-omnistudio-omniscript, building-omnistudio-flexcard, or building-omnistudio-integration-procedure), implementing Apex business logic (use generating-apex), or troubleshooting deployment pipelines (use deploying-metadata).
relationship-science-coach
IncludedUse this skill for direct, practical adult relationship coaching: couples conflict, repair, trust, marriage, dating, flirting, attachment patterns, emotional connection, sex, desire differences, eroticism, kink negotiation, affection, love languages, breakups, and long-term passion. Draw on Gottman, EFT and Hold Me Tight, attachment science, modern sex research, Perel, Nagoski, Kerner, Schnarch, Love and Stosny, and flexible love-language tools. Be concrete and low-hedge. Redirect only for imminent danger, abuse, coercive control, minors, non-consent, self-harm, stalking, or medical/legal/psychiatric decisions.
building-sf-integrations
IncludedSalesforce integration architecture and runtime plumbing with 120-point scoring. Use this skill to set up Named Credentials, External Credentials, External Services, REST/SOAP callout patterns, Platform Events, and Change Data Capture. TRIGGER when: user sets up Named Credentials, External Services, REST/SOAP callouts, Platform Events, CDC, or touches .namedCredential-meta.xml files. DO NOT TRIGGER when: Connected App/OAuth config (use configuring-connected-apps), Apex-only logic (use generating-apex), or data import/export (use handling-sf-data).
venue-templates
IncludedAccess comprehensive LaTeX templates, formatting requirements, and submission guidelines for major scientific publication venues (Nature, Science, PLOS, IEEE, ACM), academic conferences (NeurIPS, ICML, CVPR, CHI), research posters, and grant proposals (NSF, NIH, DOE, DARPA). This skill should be used when preparing manuscripts for journal submission, conference papers, research posters, or grant proposals and need venue-specific formatting requirements and templates.
let-fate-decide
IncludedDraws the 12 Houses of the Zodiac Tarot spread to inject entropy into planning when prompts are vague, ambiguous, or casually delegated. Interprets the spread to guide next steps. Use when the user says 'let fate decide', 'YOLO', 'whatever', 'idk', or other nonchalant phrases, makes Yu-Gi-Oh references, or when you are about to arbitrarily pick between multiple reasonable approaches. Prefer over ask-questions-if-underspecified when the user's tone is casual or playful rather than precision-seeking.
net-ops
IncludedCross-platform network troubleshooting (Windows, macOS, Linux) via local or remote shell. Use for: DNS broken, can't resolve hostnames, nslookup/dig works but apps fail, NRPT, WFP, scutil, /etc/resolver, systemd-resolved, /etc/resolv.conf, NetworkManager, VPN DNS leak residue (ProtonVPN/Mullvad/WireGuard/AnyConnect), AV/firewall blocking DNS or DoH, Tailscale DNS interaction, intermittent connectivity, remote diagnostics over SSH.