bio-rna-structure-ncrna-search
Searches for non-coding RNA homologs and classifies RNA families using Infernal covariance model searches against the Rfam database. Identifies structured RNAs by sequence and secondary structure conservation. Use when querying sequences against Rfam, building custom covariance models for novel RNA families, or classifying non-coding transcripts by family.
What this skill does
## Version Compatibility
Reference examples tested with: BioPython 1.83+, Infernal 1.1+, pandas 2.2+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# ncRNA Search
**"Search my sequences for known non-coding RNA families"** -> Query sequences against the Rfam database using covariance models that score both sequence and secondary structure conservation, or build custom CMs for novel RNA families.
- CLI: `cmscan` for searching against Rfam CMs
- CLI: `cmbuild` + `cmcalibrate` for building custom covariance models
Search for non-coding RNA homologs and classify RNA families using covariance models (CMs). Infernal scores both sequence and secondary structure conservation, making it more sensitive than sequence-only methods for structured RNAs.
## Rfam Database Setup
```bash
# Download current Rfam covariance models (~500 MB compressed)
wget https://ftp.ebi.ac.uk/pub/databases/Rfam/CURRENT/Rfam.cm.gz
gunzip Rfam.cm.gz
# Press the CM database (required before searching)
cmpress Rfam.cm
# Download clan information (for resolving overlapping hits)
wget https://ftp.ebi.ac.uk/pub/databases/Rfam/CURRENT/Rfam.clanin
```
## cmscan: Query Sequences Against Rfam
Search one or more query sequences against the full Rfam database to classify ncRNAs by family.
```bash
# Basic cmscan against Rfam
cmscan --cpu 8 --tblout results.tbl --fmt 2 Rfam.cm query.fa > results.out
# With clan overlap resolution (removes redundant hits from same clan)
cmscan --cpu 8 --tblout results.tbl --fmt 2 --clanin Rfam.clanin --oclan Rfam.cm query.fa > results.out
# Strict E-value threshold for high-confidence hits
cmscan --cpu 8 --tblout results.tbl --fmt 2 --clanin Rfam.clanin --oclan \
-E 1e-5 --incE 1e-5 Rfam.cm query.fa > results.out
```
### cmscan Key Options
| Option | Description |
|--------|-------------|
| `--tblout` | Tabular output (easier to parse) |
| `--fmt 2` | Format 2 tabular output (includes model coordinates) |
| `-E` | Report E-value threshold (default: 10.0) |
| `--incE` | Inclusion E-value for significant hits (default: 0.01) |
| `--clanin` | Clan file for resolving overlapping family hits |
| `--oclan` | Enable clan overlap resolution |
| `--cut_ga` | Use Rfam gathering threshold (curated per-family cutoff) |
| `--cpu` | Number of threads |
| `--noali` | Skip alignment output (faster for large searches) |
### Gathering Threshold vs E-value
```bash
# Gathering threshold: curated per-family cutoff, recommended for Rfam
# Provides consistent sensitivity per family as calibrated by Rfam curators
cmscan --cut_ga --tblout results.tbl --fmt 2 --clanin Rfam.clanin --oclan \
Rfam.cm query.fa > results.out
# E-value based: unified threshold, useful for custom databases
cmscan -E 1e-3 --tblout results.tbl Rfam.cm query.fa > results.out
```
## cmsearch: Search Specific CM Against Sequence Database
Search a specific covariance model against a sequence database (inverse of cmscan).
```bash
# Extract a single family CM from Rfam
cmfetch Rfam.cm RF00005 > tRNA.cm
cmpress tRNA.cm
# Search for tRNAs in a genome
cmsearch --cpu 8 --tblout trna_hits.tbl tRNA.cm genome.fa > trna_hits.out
# Search with bit score threshold instead of E-value
cmsearch --cpu 8 -T 30.0 --tblout hits.tbl tRNA.cm genome.fa > hits.out
```
## Building Custom Covariance Models
**Goal:** Create a covariance model for a novel RNA family not represented in Rfam, enabling sensitive homolog searches that leverage both sequence and structure conservation.
**Approach:** Prepare a Stockholm-format alignment with secondary structure annotation, build and calibrate a covariance model from the alignment, then search target sequences with the custom CM.
For novel RNA families not in Rfam, build a custom CM from a structure-annotated alignment.
### Step 1: Prepare Stockholm Alignment
```
# STOCKHOLM 1.0
#=GF AC MYFAM00001
#=GF DE My novel RNA family
seq1 GGGCUAUUAGCUCAGUUGGUUAGAGC
seq2 GGGCUAUAAGCUCAGUUGGAUAGAGC
seq3 GGGCUAUUAGCUCAGUUGGUUAGAGC
#=GC SS_cons ((((....((((......))))))))
//
```
### Step 2: Build and Calibrate
```bash
# Build CM from alignment
cmbuild my_family.cm alignment.sto
# Calibrate E-value statistics (compute-intensive but essential for accurate E-values)
cmcalibrate --cpu 8 my_family.cm
# Press for searching
cmpress my_family.cm
```
### Step 3: Search
```bash
# Search genome with custom CM
cmsearch --cpu 8 --tblout custom_hits.tbl my_family.cm target_sequences.fa > custom_hits.out
# Iterative search: use hits to refine alignment and rebuild CM
cmsearch -A new_hits.sto my_family.cm target_sequences.fa
# Then manually curate new_hits.sto and rebuild
```
### cmbuild Options
| Option | Description |
|--------|-------------|
| `--hand` | Use reference annotation for consensus (trust SS_cons exactly) |
| `--enone` | Turn off entropy weighting |
| `-n` | Name the CM |
| `--ere` | Target mean match state relative entropy |
## Parsing Infernal Output
### Tabular Output (--tblout --fmt 2)
```python
import pandas as pd
def parse_cmscan_tblout(tblout_file):
'''Parse Infernal cmscan --fmt 2 tabular output.'''
rows = []
with open(tblout_file) as f:
for line in f:
if line.startswith('#'):
continue
fields = line.strip().split()
if len(fields) < 18:
continue
rows.append({
'target_name': fields[0],
'target_accession': fields[1],
'query_name': fields[2],
'query_accession': fields[3],
'mdl_type': fields[4],
'mdl_from': int(fields[5]),
'mdl_to': int(fields[6]),
'seq_from': int(fields[7]),
'seq_to': int(fields[8]),
'strand': fields[9],
'trunc': fields[10],
'pass': fields[11],
'gc': float(fields[12]),
'bias': float(fields[13]),
'score': float(fields[14]),
'evalue': float(fields[15]),
'inc': fields[16],
'description': ' '.join(fields[17:])
})
df = pd.DataFrame(rows)
return df
def filter_significant_hits(df, evalue_threshold=1e-5):
'''Filter for significant hits and sort by score.'''
significant = df[df['evalue'] <= evalue_threshold].copy()
significant = significant.sort_values('score', ascending=False)
return significant
def summarize_families(df):
'''Summarize ncRNA family assignments.'''
summary = df.groupby('target_name').agg(
count=('query_name', 'count'),
best_score=('score', 'max'),
best_evalue=('evalue', 'min')
).sort_values('count', ascending=False)
return summary
```
### Extract Hit Sequences
```python
from Bio import SeqIO
def extract_hit_sequences(fasta_file, hits_df, output_file):
'''Extract sequences for cmscan/cmsearch hits.'''
seqs = SeqIO.to_dict(SeqIO.parse(fasta_file, 'fasta'))
records = []
for _, hit in hits_df.iterrows():
seq_record = seqs[hit['query_name']]
start, end = sorted([hit['seq_from'], hit['seq_to']])
subseq = seq_record[start-1:end]
if hit['strand'] == '-':
subseq = subseq.reverse_complement()
subseq.id = f'{hit["query_name"]}_{start}_{end}_{hit["target_name"]}'
subseq.description = f'family={hit["target_name"]} score={hit["score"]:.1f} E={hit["evalue"]:.1e}'
records.append(subseq)
SeqIO.write(records, output_file, 'fasta')
print(f'Extracted {len(records)} hit sequences to {output_file}')
```
## Quality Thresholds
| Metric | Threshold | Rationale |
|----Related in General
modeling-omnistudio-epc-catalog
IncludedSalesforce Industries CME EPC product-modeling skill for Product2-based catalog creation. Use when creating EPC products, configuring product attributes, building offer bundles with Product Child Items, or reviewing EPC DataPack JSON metadata for product catalog changes. TRIGGER when: user creates or updates Product2 EPC records, AttributeAssignment payloads, AttributeMetadata/AttributeDefaultValues, Offer bundles, or ProductChildItem relationships. DO NOT TRIGGER when: designing OmniScripts/FlexCards/Integration Procedures (use building-omnistudio-omniscript, building-omnistudio-flexcard, or building-omnistudio-integration-procedure), implementing Apex business logic (use generating-apex), or troubleshooting deployment pipelines (use deploying-metadata).
relationship-science-coach
IncludedUse this skill for direct, practical adult relationship coaching: couples conflict, repair, trust, marriage, dating, flirting, attachment patterns, emotional connection, sex, desire differences, eroticism, kink negotiation, affection, love languages, breakups, and long-term passion. Draw on Gottman, EFT and Hold Me Tight, attachment science, modern sex research, Perel, Nagoski, Kerner, Schnarch, Love and Stosny, and flexible love-language tools. Be concrete and low-hedge. Redirect only for imminent danger, abuse, coercive control, minors, non-consent, self-harm, stalking, or medical/legal/psychiatric decisions.
building-sf-integrations
IncludedSalesforce integration architecture and runtime plumbing with 120-point scoring. Use this skill to set up Named Credentials, External Credentials, External Services, REST/SOAP callout patterns, Platform Events, and Change Data Capture. TRIGGER when: user sets up Named Credentials, External Services, REST/SOAP callouts, Platform Events, CDC, or touches .namedCredential-meta.xml files. DO NOT TRIGGER when: Connected App/OAuth config (use configuring-connected-apps), Apex-only logic (use generating-apex), or data import/export (use handling-sf-data).
venue-templates
IncludedAccess comprehensive LaTeX templates, formatting requirements, and submission guidelines for major scientific publication venues (Nature, Science, PLOS, IEEE, ACM), academic conferences (NeurIPS, ICML, CVPR, CHI), research posters, and grant proposals (NSF, NIH, DOE, DARPA). This skill should be used when preparing manuscripts for journal submission, conference papers, research posters, or grant proposals and need venue-specific formatting requirements and templates.
let-fate-decide
IncludedDraws the 12 Houses of the Zodiac Tarot spread to inject entropy into planning when prompts are vague, ambiguous, or casually delegated. Interprets the spread to guide next steps. Use when the user says 'let fate decide', 'YOLO', 'whatever', 'idk', or other nonchalant phrases, makes Yu-Gi-Oh references, or when you are about to arbitrarily pick between multiple reasonable approaches. Prefer over ask-questions-if-underspecified when the user's tone is casual or playful rather than precision-seeking.
net-ops
IncludedCross-platform network troubleshooting (Windows, macOS, Linux) via local or remote shell. Use for: DNS broken, can't resolve hostnames, nslookup/dig works but apps fail, NRPT, WFP, scutil, /etc/resolver, systemd-resolved, /etc/resolv.conf, NetworkManager, VPN DNS leak residue (ProtonVPN/Mullvad/WireGuard/AnyConnect), AV/firewall blocking DNS or DoH, Tailscale DNS interaction, intermittent connectivity, remote diagnostics over SSH.