bio-small-rna-seq-smrna-preprocessing
Preprocess small RNA sequencing data with adapter trimming and size selection optimized for miRNA, piRNA, and other small RNAs. Use when preparing small RNA-seq reads for downstream quantification or discovery analysis.
What this skill does
## Version Compatibility
Reference examples tested with: cutadapt 4.4+, fastp 0.23+, matplotlib 3.8+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# Small RNA Preprocessing
**"Preprocess my small RNA-seq reads"** -> Remove 3' adapter sequences and size-select reads in the small RNA range (18-30 nt for miRNA, 24-32 nt for piRNA) before quantification or discovery.
- CLI: `cutadapt -a ADAPTER -m 18 -M 30 -o trimmed.fastq input.fastq`
## Adapter Trimming with Cutadapt
**Goal:** Remove 3' adapter sequences and size-select reads in the small RNA range.
**Approach:** Run cutadapt with the kit-specific adapter, minimum/maximum length filters, and discard reads without adapter.
Small RNA libraries have specific 3' adapters that must be removed:
```bash
# Standard Illumina TruSeq small RNA adapter
cutadapt \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 \
-M 30 \
--discard-untrimmed \
-o trimmed.fastq.gz \
input.fastq.gz
# -a: 3' adapter sequence
# -m 18: Minimum length (miRNAs are 18-25 nt)
# -M 30: Maximum length (exclude longer fragments)
# --discard-untrimmed: Remove reads without adapter (likely not small RNA)
```
## Common Small RNA Adapters
| Kit | 3' Adapter Sequence |
|-----|---------------------|
| Illumina TruSeq | TGGAATTCTCGGGTGCCAAGG |
| NEBNext | AGATCGGAAGAGCACACGTCT |
| QIAseq | AACTGTAGGCACCATCAAT |
| Lexogen | TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC |
## Size Selection
```bash
# Filter by length after trimming
cutadapt \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 -M 26 \
-o mirna_length.fastq.gz \
input.fastq.gz
# miRNA: 18-26 nt (typically 21-23 nt)
# piRNA: 26-32 nt
# snoRNA: variable, typically longer
```
## Quality Trimming
```bash
# Trim low-quality bases from 3' end before adapter removal
cutadapt \
-q 20 \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 \
-o trimmed.fastq.gz \
input.fastq.gz
```
## Using fastp for Small RNA
```bash
# fastp with small RNA settings
fastp \
--in1 input.fastq.gz \
--out1 trimmed.fastq.gz \
--adapter_sequence TGGAATTCTCGGGTGCCAAGG \
--length_required 18 \
--length_limit 30 \
--html report.html
# Note: fastp auto-detects adapters but specifying is more reliable
```
## Collapse Identical Reads
For small RNAs, collapsing identical sequences reduces computation:
```bash
# Using seqkit
seqkit rmdup -s trimmed.fastq.gz -o collapsed.fasta
# Using fastx_toolkit (legacy)
fastx_collapser -i trimmed.fastq -o collapsed.fasta
```
## Python Preprocessing
```python
import gzip
from collections import Counter
def collapse_reads(fastq_path):
'''Collapse identical sequences and count occurrences'''
counts = Counter()
with gzip.open(fastq_path, 'rt') as f:
while True:
header = f.readline()
if not header:
break
seq = f.readline().strip()
f.readline() # +
f.readline() # qual
# Only keep reads in miRNA size range
if 18 <= len(seq) <= 26:
counts[seq] += 1
return counts
# Write collapsed FASTA
def write_collapsed_fasta(counts, output_path):
with open(output_path, 'w') as f:
for i, (seq, count) in enumerate(counts.most_common()):
f.write(f'>seq_{i}_x{count}\n{seq}\n')
```
## QC Metrics for Small RNA
Key metrics to check:
- Read length distribution (should peak at 21-23 nt for miRNA)
- Adapter content (high if library is good)
- Percentage of reads in target size range
```python
import matplotlib.pyplot as plt
from collections import Counter
def plot_length_distribution(fastq_path):
lengths = Counter()
with gzip.open(fastq_path, 'rt') as f:
for i, line in enumerate(f):
if i % 4 == 1: # Sequence line
lengths[len(line.strip())] += 1
plt.bar(lengths.keys(), lengths.values())
plt.xlabel('Read Length')
plt.ylabel('Count')
plt.title('Small RNA Length Distribution')
plt.savefig('length_dist.png')
```
## Related Skills
- mirdeep2-analysis - Novel miRNA discovery
- mirge3-analysis - Fast miRNA quantification
- read-qc/adapter-trimming - General adapter trimming
Related in General
modeling-omnistudio-epc-catalog
IncludedSalesforce Industries CME EPC product-modeling skill for Product2-based catalog creation. Use when creating EPC products, configuring product attributes, building offer bundles with Product Child Items, or reviewing EPC DataPack JSON metadata for product catalog changes. TRIGGER when: user creates or updates Product2 EPC records, AttributeAssignment payloads, AttributeMetadata/AttributeDefaultValues, Offer bundles, or ProductChildItem relationships. DO NOT TRIGGER when: designing OmniScripts/FlexCards/Integration Procedures (use building-omnistudio-omniscript, building-omnistudio-flexcard, or building-omnistudio-integration-procedure), implementing Apex business logic (use generating-apex), or troubleshooting deployment pipelines (use deploying-metadata).
relationship-science-coach
IncludedUse this skill for direct, practical adult relationship coaching: couples conflict, repair, trust, marriage, dating, flirting, attachment patterns, emotional connection, sex, desire differences, eroticism, kink negotiation, affection, love languages, breakups, and long-term passion. Draw on Gottman, EFT and Hold Me Tight, attachment science, modern sex research, Perel, Nagoski, Kerner, Schnarch, Love and Stosny, and flexible love-language tools. Be concrete and low-hedge. Redirect only for imminent danger, abuse, coercive control, minors, non-consent, self-harm, stalking, or medical/legal/psychiatric decisions.
building-sf-integrations
IncludedSalesforce integration architecture and runtime plumbing with 120-point scoring. Use this skill to set up Named Credentials, External Credentials, External Services, REST/SOAP callout patterns, Platform Events, and Change Data Capture. TRIGGER when: user sets up Named Credentials, External Services, REST/SOAP callouts, Platform Events, CDC, or touches .namedCredential-meta.xml files. DO NOT TRIGGER when: Connected App/OAuth config (use configuring-connected-apps), Apex-only logic (use generating-apex), or data import/export (use handling-sf-data).
venue-templates
IncludedAccess comprehensive LaTeX templates, formatting requirements, and submission guidelines for major scientific publication venues (Nature, Science, PLOS, IEEE, ACM), academic conferences (NeurIPS, ICML, CVPR, CHI), research posters, and grant proposals (NSF, NIH, DOE, DARPA). This skill should be used when preparing manuscripts for journal submission, conference papers, research posters, or grant proposals and need venue-specific formatting requirements and templates.
let-fate-decide
IncludedDraws the 12 Houses of the Zodiac Tarot spread to inject entropy into planning when prompts are vague, ambiguous, or casually delegated. Interprets the spread to guide next steps. Use when the user says 'let fate decide', 'YOLO', 'whatever', 'idk', or other nonchalant phrases, makes Yu-Gi-Oh references, or when you are about to arbitrarily pick between multiple reasonable approaches. Prefer over ask-questions-if-underspecified when the user's tone is casual or playful rather than precision-seeking.
net-ops
IncludedCross-platform network troubleshooting (Windows, macOS, Linux) via local or remote shell. Use for: DNS broken, can't resolve hostnames, nslookup/dig works but apps fail, NRPT, WFP, scutil, /etc/resolver, systemd-resolved, /etc/resolv.conf, NetworkManager, VPN DNS leak residue (ProtonVPN/Mullvad/WireGuard/AnyConnect), AV/firewall blocking DNS or DoH, Tailscale DNS interaction, intermittent connectivity, remote diagnostics over SSH.