bio-workflows-smrna-pipeline

Included with Lifetime

$97 forever

End-to-end small RNA-seq analysis from FASTQ to differential miRNA expression. Use when analyzing miRNA, piRNA, or other small RNA sequencing data.

General

What this skill does


## Version Compatibility

Reference examples tested with: DESeq2 1.42+, cutadapt 4.4+

Before using code patterns, verify installed versions match. If versions differ:
- R: `packageVersion('<pkg>')` then `?function_name` to verify parameters
- CLI: `<tool> --version` then `<tool> --help` to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.

# Small RNA-seq Pipeline

**"Analyze my small RNA-seq data from FASTQ to differential miRNAs"** -> Orchestrate adapter trimming (cutadapt), miRNA quantification (miRDeep2/miRge3), novel miRNA discovery, differential expression (DESeq2), and target prediction (miRanda).

## Pipeline Overview

```
FASTQ -> cutadapt trim -> miRDeep2 -> Quantification -> DESeq2 -> Target prediction
```

## Step 1: Preprocessing

```bash
# Adapter trimming and size selection
cutadapt -a TGGAATTCTCGGGTGCCAAGG \
    --minimum-length 18 --maximum-length 30 \
    -o trimmed.fastq.gz reads.fastq.gz
```

## Step 2: miRDeep2 Analysis

```bash
# Align to genome
mapper.pl trimmed.fastq.gz -e -h -i -j -l 18 \
    -m -p genome_index -s reads_collapsed.fa \
    -t reads_collapsed_vs_genome.arf

# miRNA quantification and novel prediction
miRDeep2.pl reads_collapsed.fa genome.fa \
    reads_collapsed_vs_genome.arf \
    mature_ref.fa none hairpin_ref.fa
```

## Step 3: Differential Expression

```r
library(DESeq2)
counts <- read.csv('mirna_counts.csv', row.names = 1)
dds <- DESeqDataSetFromMatrix(counts, colData, ~condition)
dds <- DESeq(dds)
results <- results(dds)
```

## Step 4: Target Prediction

```bash
# miRanda for target prediction
miranda mature_mirnas.fa target_3utrs.fa -out targets.txt
```

## QC Checkpoints

1. **After trimming**: Size distribution should peak at 21-23nt
2. **After alignment**: >70% mapping rate expected
3. **After DE**: Check volcano plot and PCA

## Related Skills

- small-rna-seq/mirdeep2-analysis - Detailed miRDeep2
- small-rna-seq/differential-mirna - DE analysis
- small-rna-seq/target-prediction - Target analysis

Files: 3

Size: 5.9 KB

Complexity: 16/100

Category: General

Source: https://github.com/gptomics/bioskills/tree/main/workflows/smrna-pipeline

Related in General

modeling-omnistudio-epc-catalog

Included

Salesforce Industries CME EPC product-modeling skill for Product2-based catalog creation. Use when creating EPC products, configuring product attributes, building offer bundles with Product Child Items, or reviewing EPC DataPack JSON metadata for product catalog changes. TRIGGER when: user creates or updates Product2 EPC records, AttributeAssignment payloads, AttributeMetadata/AttributeDefaultValues, Offer bundles, or ProductChildItem relationships. DO NOT TRIGGER when: designing OmniScripts/FlexCards/Integration Procedures (use building-omnistudio-omniscript, building-omnistudio-flexcard, or building-omnistudio-integration-procedure), implementing Apex business logic (use generating-apex), or troubleshooting deployment pipelines (use deploying-metadata).

Generalscripts

relationship-science-coach

Included

Use this skill for direct, practical adult relationship coaching: couples conflict, repair, trust, marriage, dating, flirting, attachment patterns, emotional connection, sex, desire differences, eroticism, kink negotiation, affection, love languages, breakups, and long-term passion. Draw on Gottman, EFT and Hold Me Tight, attachment science, modern sex research, Perel, Nagoski, Kerner, Schnarch, Love and Stosny, and flexible love-language tools. Be concrete and low-hedge. Redirect only for imminent danger, abuse, coercive control, minors, non-consent, self-harm, stalking, or medical/legal/psychiatric decisions.

Generalscripts

building-sf-integrations

Included

Salesforce integration architecture and runtime plumbing with 120-point scoring. Use this skill to set up Named Credentials, External Credentials, External Services, REST/SOAP callout patterns, Platform Events, and Change Data Capture. TRIGGER when: user sets up Named Credentials, External Services, REST/SOAP callouts, Platform Events, CDC, or touches .namedCredential-meta.xml files. DO NOT TRIGGER when: Connected App/OAuth config (use configuring-connected-apps), Apex-only logic (use generating-apex), or data import/export (use handling-sf-data).

Generalscripts

venue-templates

Included

Access comprehensive LaTeX templates, formatting requirements, and submission guidelines for major scientific publication venues (Nature, Science, PLOS, IEEE, ACM), academic conferences (NeurIPS, ICML, CVPR, CHI), research posters, and grant proposals (NSF, NIH, DOE, DARPA). This skill should be used when preparing manuscripts for journal submission, conference papers, research posters, or grant proposals and need venue-specific formatting requirements and templates.

Generalscripts

let-fate-decide

Included

Draws the 12 Houses of the Zodiac Tarot spread to inject entropy into planning when prompts are vague, ambiguous, or casually delegated. Interprets the spread to guide next steps. Use when the user says 'let fate decide', 'YOLO', 'whatever', 'idk', or other nonchalant phrases, makes Yu-Gi-Oh references, or when you are about to arbitrarily pick between multiple reasonable approaches. Prefer over ask-questions-if-underspecified when the user's tone is casual or playful rather than precision-seeking.

Generalscripts

net-ops

Included

Cross-platform network troubleshooting (Windows, macOS, Linux) via local or remote shell. Use for: DNS broken, can't resolve hostnames, nslookup/dig works but apps fail, NRPT, WFP, scutil, /etc/resolver, systemd-resolved, /etc/resolv.conf, NetworkManager, VPN DNS leak residue (ProtonVPN/Mullvad/WireGuard/AnyConnect), AV/firewall blocking DNS or DoH, Tailscale DNS interaction, intermittent connectivity, remote diagnostics over SSH.

Generalscripts