scikit-bio
Biological data toolkit. Sequence analysis, alignments, phylogenetic trees, diversity metrics (alpha/beta, UniFrac), ordination (PCoA), PERMANOVA, FASTA/Newick I/O, for microbiome analysis.
What this skill does
# scikit-bio
## Overview
scikit-bio is a comprehensive Python library for working with biological data. Apply this skill for bioinformatics analyses spanning sequence manipulation, alignment, phylogenetics, microbial ecology, and multivariate statistics.
## When to Use This Skill
This skill should be used when the user:
- Works with biological sequences (DNA, RNA, protein)
- Needs to read/write biological file formats (FASTA, FASTQ, GenBank, Newick, BIOM, etc.)
- Performs sequence alignments or searches for motifs
- Constructs or analyzes phylogenetic trees
- Calculates diversity metrics (alpha/beta diversity, UniFrac distances)
- Performs ordination analysis (PCoA, CCA, RDA)
- Runs statistical tests on biological/ecological data (PERMANOVA, ANOSIM, Mantel)
- Analyzes microbiome or community ecology data
- Works with protein embeddings from language models
- Needs to manipulate biological data tables
## Core Capabilities
### 1. Sequence Manipulation
Work with biological sequences using specialized classes for DNA, RNA, and protein data.
**Key operations:**
- Read/write sequences from FASTA, FASTQ, GenBank, EMBL formats
- Sequence slicing, concatenation, and searching
- Reverse complement, transcription (DNA→RNA), and translation (RNA→protein)
- Find motifs and patterns using regex
- Calculate distances (Hamming, k-mer based)
- Handle sequence quality scores and metadata
**Common patterns:**
```python
import skbio
# Read sequences from file
seq = skbio.DNA.read('input.fasta')
# Sequence operations
rc = seq.reverse_complement()
rna = seq.transcribe()
protein = rna.translate()
# Find motifs
motif_positions = seq.find_with_regex('ATG[ACGT]{3}')
# Check for properties
has_degens = seq.has_degenerates()
seq_no_gaps = seq.degap()
```
**Important notes:**
- Use `DNA`, `RNA`, `Protein` classes for grammared sequences with validation
- Use `Sequence` class for generic sequences without alphabet restrictions
- Quality scores automatically loaded from FASTQ files into positional metadata
- Metadata types: sequence-level (ID, description), positional (per-base), interval (regions/features)
### 2. Sequence Alignment
Perform pairwise and multiple sequence alignments using the `pair_align` engine (introduced in scikit-bio 0.7.0), a versatile and efficient dynamic-programming aligner.
**Key capabilities:**
- Global, local, and semi-global alignment (free ends configurable) in one function
- Convenience wrappers `pair_align_nucl` (BLASTN-like) and `pair_align_prot` (BLASTP-like)
- Configurable scoring: match/mismatch tuple or named substitution matrix; linear or affine gap penalties
- `PairAlignPath` results carry CIGAR strings and convert to aligned sequences
- Multiple sequence alignment storage and manipulation with `TabularMSA`
**Common patterns:**
```python
from skbio import DNA, Protein
from skbio.alignment import pair_align_nucl, pair_align_prot, pair_align, TabularMSA
# Nucleotide alignment with BLASTN-like defaults
seq1, seq2 = DNA('ACTACCAGATTACTTACGGATCAGG'), DNA('CGAAACTACTAGATTACGGATCTTA')
aln = pair_align_nucl(seq1, seq2)
aln.score # alignment score (float)
path = aln.paths[0] # PairAlignPath (repr shows CIGAR)
aligned_seqs = path.to_aligned((seq1, seq2)) # list of gapped strings
# Build a TabularMSA from the alignment path + original sequences
msa = TabularMSA.from_path_seqs(path, (seq1, seq2))
# Customize the algorithm via pair_align (default mode='global')
aln = pair_align(seq1, seq2, mode='local') # Smith-Waterman
aln = pair_align(seq1, seq2, sub_score=(2, -3), gap_cost=(5, 2)) # affine gaps
aln = pair_align(seq1, seq2, sub_score='NUC.4.4', gap_cost=3) # substitution matrix, linear gap
# Protein alignment (BLASTP-like, BLOSUM62)
aln = pair_align_prot(Protein('HEAGAWGHEE'), Protein('PAWHEAE'))
# Read a multiple alignment from file and summarize
msa = TabularMSA.read('alignment.fasta', constructor=DNA)
consensus = msa.consensus()
```
**Important notes:**
- `pair_align` replaces the removed SSW wrapper (`local_pairwise_align_ssw`, `StripedSmithWaterman`) and the deprecated pure-Python aligners (`global_pairwise_align`, `local_pairwise_align_nucleotide`, etc.)
- The result is a `PairAlignResult` that also unpacks as `score, paths, matrices` (use `keep_matrices=True` to retain the DP matrix)
- `sub_score` accepts a `(match, mismatch)` tuple or a matrix name (e.g., `'NUC.4.4'`, `'BLOSUM62'`); `gap_cost` accepts a single number (linear) or `(open, extend)` tuple (affine)
- Parse external CIGAR strings with `PairAlignPath.from_cigar('1I8M2D5M2I')`; score an existing alignment with `align_score(...)` and build a distance matrix from an MSA with `align_dists(...)`
### 3. Phylogenetic Trees
Construct, manipulate, and analyze phylogenetic trees representing evolutionary relationships.
**Key capabilities:**
- Tree construction from distance matrices (UPGMA/WPGMA, Neighbor Joining, GME, BME)
- Tree rearrangement with nearest neighbor interchange (`nni`)
- Tree manipulation (pruning, rerooting, traversal)
- Distance calculations (patristic via `cophenet`, Robinson-Foulds via `compare_rfd`)
- ASCII visualization
- Newick format I/O
**Common patterns:**
```python
from skbio import TreeNode
from skbio.tree import nj, upgma, gme, bme, rf_dists
# Read tree from file
tree = TreeNode.read('tree.nwk')
# Construct tree from distance matrix
tree = nj(distance_matrix)
# Tree operations
subtree = tree.shear(['taxon1', 'taxon2', 'taxon3'])
tips = [node for node in tree.tips()]
lca = tree.lca(['taxon1', 'taxon2'])
# Calculate distances
patristic_dist = tree.find('taxon1').distance(tree.find('taxon2'))
cophenetic_dm = tree.cophenet() # patristic distance matrix among tips
# Compare two trees (Robinson-Foulds)
rf_distance = tree.compare_rfd(other_tree)
# Pairwise RF distances among many trees -> DistanceMatrix
rf_dm = rf_dists([tree, other_tree, third_tree])
```
**Important notes:**
- Use `nj()` for neighbor joining (classic phylogenetic method)
- Use `upgma()` for UPGMA/WPGMA (assumes molecular clock)
- GME and BME are highly scalable for large trees; refine topology with `nni()`
- `cophenet()` (formerly `tip_tip_distances`) returns the patristic distance matrix; `compare_rfd()` is the Robinson-Foulds method (`compare_wrfd`/`compare_cophenet` for weighted/cophenetic variants)
- `lca()` is the lowest common ancestor; `lowest_common_ancestor` remains as an alias
- Trees can be rooted or unrooted; some metrics require specific rooting
### 4. Diversity Analysis
Calculate alpha and beta diversity metrics for microbial ecology and community analysis.
**Key capabilities:**
- Alpha diversity: richness (`sobs`, `observed_features`, `chao1`, `ace`), Shannon, Simpson, Hill numbers (`hill`), Faith's PD (`faith_pd`), generalized PD (`phydiv`), Pielou's evenness
- Beta diversity: Bray-Curtis, Jaccard, weighted/unweighted UniFrac, Euclidean distances
- Phylogenetic diversity metrics (require tree input)
- Rarefaction and subsampling
- Integration with ordination and statistical tests
**Common patterns:**
```python
from skbio.diversity import alpha_diversity, beta_diversity
# Alpha diversity (phylogenetic metrics take taxa= for tip-name mapping)
alpha = alpha_diversity('shannon', counts_matrix, ids=sample_ids)
faith_pd = alpha_diversity('faith_pd', counts_matrix, ids=sample_ids,
tree=tree, taxa=feature_ids)
# Beta diversity
bc_dm = beta_diversity('braycurtis', counts_matrix, ids=sample_ids)
unifrac_dm = beta_diversity('unweighted_unifrac', counts_matrix,
ids=sample_ids, tree=tree, taxa=feature_ids)
# Get available metrics
from skbio.diversity import get_alpha_diversity_metrics
print(get_alpha_diversity_metrics())
```
**Important notes:**
- Counts must be integers representing abundances, not relative frequencies
- The phylogenetic-metric argument is `taxa=` (renamed from `otu_ids` in 0.6.0; the old name is Related in General
modeling-omnistudio-epc-catalog
IncludedSalesforce Industries CME EPC product-modeling skill for Product2-based catalog creation. Use when creating EPC products, configuring product attributes, building offer bundles with Product Child Items, or reviewing EPC DataPack JSON metadata for product catalog changes. TRIGGER when: user creates or updates Product2 EPC records, AttributeAssignment payloads, AttributeMetadata/AttributeDefaultValues, Offer bundles, or ProductChildItem relationships. DO NOT TRIGGER when: designing OmniScripts/FlexCards/Integration Procedures (use building-omnistudio-omniscript, building-omnistudio-flexcard, or building-omnistudio-integration-procedure), implementing Apex business logic (use generating-apex), or troubleshooting deployment pipelines (use deploying-metadata).
relationship-science-coach
IncludedUse this skill for direct, practical adult relationship coaching: couples conflict, repair, trust, marriage, dating, flirting, attachment patterns, emotional connection, sex, desire differences, eroticism, kink negotiation, affection, love languages, breakups, and long-term passion. Draw on Gottman, EFT and Hold Me Tight, attachment science, modern sex research, Perel, Nagoski, Kerner, Schnarch, Love and Stosny, and flexible love-language tools. Be concrete and low-hedge. Redirect only for imminent danger, abuse, coercive control, minors, non-consent, self-harm, stalking, or medical/legal/psychiatric decisions.
building-sf-integrations
IncludedSalesforce integration architecture and runtime plumbing with 120-point scoring. Use this skill to set up Named Credentials, External Credentials, External Services, REST/SOAP callout patterns, Platform Events, and Change Data Capture. TRIGGER when: user sets up Named Credentials, External Services, REST/SOAP callouts, Platform Events, CDC, or touches .namedCredential-meta.xml files. DO NOT TRIGGER when: Connected App/OAuth config (use configuring-connected-apps), Apex-only logic (use generating-apex), or data import/export (use handling-sf-data).
venue-templates
IncludedAccess comprehensive LaTeX templates, formatting requirements, and submission guidelines for major scientific publication venues (Nature, Science, PLOS, IEEE, ACM), academic conferences (NeurIPS, ICML, CVPR, CHI), research posters, and grant proposals (NSF, NIH, DOE, DARPA). This skill should be used when preparing manuscripts for journal submission, conference papers, research posters, or grant proposals and need venue-specific formatting requirements and templates.
let-fate-decide
IncludedDraws the 12 Houses of the Zodiac Tarot spread to inject entropy into planning when prompts are vague, ambiguous, or casually delegated. Interprets the spread to guide next steps. Use when the user says 'let fate decide', 'YOLO', 'whatever', 'idk', or other nonchalant phrases, makes Yu-Gi-Oh references, or when you are about to arbitrarily pick between multiple reasonable approaches. Prefer over ask-questions-if-underspecified when the user's tone is casual or playful rather than precision-seeking.
net-ops
IncludedCross-platform network troubleshooting (Windows, macOS, Linux) via local or remote shell. Use for: DNS broken, can't resolve hostnames, nslookup/dig works but apps fail, NRPT, WFP, scutil, /etc/resolver, systemd-resolved, /etc/resolv.conf, NetworkManager, VPN DNS leak residue (ProtonVPN/Mullvad/WireGuard/AnyConnect), AV/firewall blocking DNS or DoH, Tailscale DNS interaction, intermittent connectivity, remote diagnostics over SSH.